View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_45 (Length: 265)
Name: NF17657_low_45
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 43341668 - 43341902
Alignment:
| Q |
11 |
ttggtgtttttaagcccagtctttactctgcattgtcttagtctaccctaaattattgctgttgaatcagtccattgactcgagaagtcaatcactatta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
43341668 |
ttggtgtttttaagcccagtctttactctgcattgtcttagtctaccctaaattattgctgttgaatcagtccattgactagagaagtcaatcattatta |
43341767 |
T |
|
| Q |
111 |
atagtattcaatagaatagtttcactaatttggatcattttagcctcatgtactaacttttgtttaaggcacgaaaaaagaatgagaaactaaaacaagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43341768 |
atagtattcaatagaatagtttcactaatttggatcattttagcctcatgtactaacttttgtttaaggcacgaaaaaagaatgagaaactaaaacaagg |
43341867 |
T |
|
| Q |
211 |
caaagggtttggttaaccaaaaatgttaatgagta |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
43341868 |
caaagggtttggttaaccaaaattgttaatgagta |
43341902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University