View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_53 (Length: 249)
Name: NF17657_low_53
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 24852747 - 24852538
Alignment:
| Q |
19 |
tgaacaaatggtcattgtacatagatgtgtttgaacaatttttgatgactttaagtatcaaaatttctaagaacatggtccacgtccatctatctatatc |
118 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||| ||||||||| ||| |
|
|
| T |
24852747 |
tgaataaatggtcattgtacagagatgtgtttgaacaaattttgatgactttaagtatcaaaatttccaagaacatg-tccacatccatctat----atc |
24852653 |
T |
|
| Q |
119 |
atgtgataattatcctagagaaatttagtaaactaatcctaatatcaatgaggctgcaatttagcaagaggaaaattatgctgtttcacttagtctgata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||| ||||||||| |||||||| |
|
|
| T |
24852652 |
atgtgataattatcctagagaaatttagtaaactaatcctaatatcaatgaggctgcaatttcgtaggaggaaaattatgccgtttcacttggtctgata |
24852553 |
T |
|
| Q |
219 |
tgaagagttaaaaac |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24852552 |
tgaagagttaaaaac |
24852538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University