View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_55 (Length: 245)
Name: NF17657_low_55
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 45895241 - 45895041
Alignment:
| Q |
18 |
agtagcaggaggtggagctaaatatggacccgctgcagtgtcttttgattgatcgtcatatgctacagtataattccaaaatacaattacgaataatata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| || |||||| |
|
|
| T |
45895241 |
agtagcaggaggtggagctaaatatggacccactgcagtgtcttttgattgatcatcatatgctacagtataattccaaaatgcaattacaaacaatata |
45895142 |
T |
 |
| Q |
118 |
cacaattttgtcnnnnnnnnnnnnnntaatatacacaacagcattggaattaataagagtatatcttttaattaactacaaaatcttcttttacacacta |
217 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45895141 |
cacaactttgtcaaaaaaataaaaaataatatacacaacagcattggaattaataagagtatttcttttaattaactacaaaatcttcttttacacacta |
45895042 |
T |
 |
| Q |
218 |
a |
218 |
Q |
| |
|
| |
|
|
| T |
45895041 |
a |
45895041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University