View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17657_low_56 (Length: 245)

Name: NF17657_low_56
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17657_low_56
NF17657_low_56
[»] chr1 (2 HSPs)
chr1 (102-227)||(11358060-11358184)
chr1 (4-34)||(11357962-11357992)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 102 - 227
Target Start/End: Original strand, 11358060 - 11358184
Alignment:
102 gatggatcaaacctagacatggnnnnnnngttaatccactgagctacaccatcagaatagtttctgattttttgttgttgttatatacatgtaacatgcc 201  Q
    ||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
11358060 gatggatcaaacctagacatggtttttttgttaatccactgagctacaccatcagaatagtttctgattttttgttgtt-ttatatacatgtaacatgcc 11358158  T
202 atgttttagagtaatttgttcttttt 227  Q
    ||||||||||||||||||||||||||    
11358159 atgttttagagtaatttgttcttttt 11358184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 34
Target Start/End: Original strand, 11357962 - 11357992
Alignment:
4 gttgcagctaagcgtggccatttgggtatag 34  Q
    |||||||||||||||||||||||||||||||    
11357962 gttgcagctaagcgtggccatttgggtatag 11357992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University