View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17658_high_11 (Length: 214)
Name: NF17658_high_11
Description: NF17658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17658_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 42 - 198
Target Start/End: Complemental strand, 17390023 - 17389869
Alignment:
| Q |
42 |
gaatctgacatgaatgtaaaatattaatatttgacttacacattcatctgcaactccttgaacattgtcattatcaataactccatccttattgacacgg |
141 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
17390023 |
gaatctgacatgcatgcaaaatattaatatttgacttacacattcatccacaactccttcaacattttcattatcaatcactccatccttattgacacgg |
17389924 |
T |
|
| Q |
142 |
gcaaccttctatacactcgacaaagggttaccagatcatttcctgactcttctatct |
198 |
Q |
| |
|
||||||||| | ||| ||||| |||||||| ||||||| || ||||||||||||| |
|
|
| T |
17389923 |
gcaaccttc--caaacttgacaacgggttaccggatcattaccggactcttctatct |
17389869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 59 - 198
Target Start/End: Complemental strand, 20752721 - 20752584
Alignment:
| Q |
59 |
aaaatattaatatttgacttacacattcatctgcaactccttgaacattgtcattatcaataactccatccttattgacacgggcaaccttctatacact |
158 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
20752721 |
aaaatattaagctttgacttacacattcatccacaacttcttgaacattgtcattatcaatcactccatccttattgacacgggcagccttc--cacact |
20752624 |
T |
|
| Q |
159 |
cgacaaagggttaccagatcatttcctgactcttctatct |
198 |
Q |
| |
|
|||| |||||||| ||||||| | ||||||||||||| |
|
|
| T |
20752623 |
tgacatcgggttaccgaatcattttcagactcttctatct |
20752584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 15529492 - 15529453
Alignment:
| Q |
1 |
aaataaataaataaattaagttagaactataaattacttg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15529492 |
aaataaataaataaattaagttagaactataaattacttg |
15529453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University