View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17658_low_9 (Length: 266)
Name: NF17658_low_9
Description: NF17658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17658_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 21 - 262
Target Start/End: Original strand, 15213803 - 15214045
Alignment:
| Q |
21 |
gtggcctctcattggattattactatagcatgaagtaccttatacggtcatacaaaattagtataattacataggaaacttaattaaatcaaatgataac |
120 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15213803 |
gtggtctctcattggattattactatagcatgaagtaccttatacggtcatacaaaatttgtataattacataggaaacttaattaaatcaaatgataac |
15213902 |
T |
 |
| Q |
121 |
aagatatggtgtggtgggtgggtggctagagcatagagatatttatttataattttcaacc-tatagtacacatttttctgaccatgcacaaacactaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15213903 |
aagatatggtgtggtgggtgggtggctagagcatggagatatttatttataattttcaaccttacagtacacatttttctgaccatgcacaaacactaag |
15214002 |
T |
 |
| Q |
220 |
accaacataacaaacaaaaagagtcccaaacatgatgatgtcc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15214003 |
accaacataacaaacaaaaagagtcccaaacatgatgttgtcc |
15214045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University