View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1765_high_8 (Length: 217)
Name: NF1765_high_8
Description: NF1765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1765_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 9e-29; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 30904090 - 30904154
Alignment:
| Q |
21 |
acagacatgcacaaaattgaaaagcaagtgccaaataatcacttcatttaatattgtgaatttta |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30904090 |
acagacatgcacaaaattgaaaagcaagtgccaaataatcacttcatttaatattgtgaatttta |
30904154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 118 - 200
Target Start/End: Original strand, 30904148 - 30904231
Alignment:
| Q |
118 |
aattttattaagaaaaactaattttgaattttgtttttggctctactcatacata-actcaaatgtaacatctcttacagattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||| ||||||| |
|
|
| T |
30904148 |
aattttattaagaaaaactaattttgaattttgtttttggctctactcatacatatactcaaatgaaacaactcttgcagattt |
30904231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 53 - 145
Target Start/End: Original strand, 30897149 - 30897242
Alignment:
| Q |
53 |
aaataatcacttcatttaatattgtgaattttagcca-ttgatttctcttatactggttt-ttaaccaattttattaagaaaaactaattttgaa |
145 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| | ||| |||||||||| || ||| |||| ||||||| ||| ||||| ||||||||||| |
|
|
| T |
30897149 |
aaataatcacttcatttaatatt-tgaattttagcaatttgttttctcttattttgatttcttaaacaattttgttacgaaaagctaattttgaa |
30897242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University