View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1765_low_8 (Length: 248)
Name: NF1765_low_8
Description: NF1765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1765_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 45045991 - 45046204
Alignment:
| Q |
16 |
ttatgagaaacgaatcctagaaacaattttccttaatttgattatcgatttcctattcagattgataaaagggggtgttattaaaaatataataaaataa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45045991 |
ttatgagaaacgaatcctagaaacaattttccttaatttgattatcggtttcctattcagattgataaaagggggtgttattaaaaatataataaaataa |
45046090 |
T |
 |
| Q |
116 |
gcatggataaaagcagctatcgaagtaaatgtcacattttatgcaaattttatgatcaatagatgttagaagtgtgagatcgggaattgaggtagaggtg |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45046091 |
gcatggataaaagcagctatcgaaggaaatgtcacattttatgcaaattttatgatcaatagatgttagaagtgtgagatcgggaattgaggtagaggtg |
45046190 |
T |
 |
| Q |
216 |
caaactttcttttg |
229 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
45046191 |
caaacttttttttg |
45046204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University