View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17660_high_21 (Length: 335)
Name: NF17660_high_21
Description: NF17660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17660_high_21 |
 |  |
|
| [»] scaffold0234 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 21 - 175
Target Start/End: Complemental strand, 19138515 - 19138361
Alignment:
| Q |
21 |
acatcatcaatggcccccttgtgaattgtcaggtgtatgtagttttaatccaagacattaaagacctcatctctcaaaccaatgtctctattactcatat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19138515 |
acatcatcaatggcccccttgtgaattgtcagatgtatgtagttttaatccaagacattaaagacctcatctctcaaaccattgtctctattactcatat |
19138416 |
T |
 |
| Q |
121 |
tctaatagaagggaactagtgtgcagattttctggtgaagcttagaacctcatca |
175 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
19138415 |
tctaatagaagggaactagcgtgcagattttctgatgaagcttagaacctcatca |
19138361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 17164670 - 17164592
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
17164670 |
tcacctttagttacatcggttgccacccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttatgtagtagtg |
17164592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 36250577 - 36250655
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36250577 |
tcacccttagttacatcggttggtacccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgtagtagtg |
36250655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 252 - 311
Target Start/End: Complemental strand, 19138360 - 19138301
Alignment:
| Q |
252 |
gattctagtttgctaattcatgggtaacattcagaatcctcaatctgctaaggaatgatg |
311 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
19138360 |
gattctagtttgctaattcatgggtaatcttcagaatcctcaatctgctgaggaatgatg |
19138301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 251
Target Start/End: Original strand, 19877507 - 19877559
Alignment:
| Q |
199 |
ccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
19877507 |
ccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttttgtagtagtg |
19877559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 32213020 - 32212942
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||| ||||| ||| || ||||||||||||||||||||| |||||| |
|
|
| T |
32213020 |
tcacctttagttacatcggttgggacccgatgtaaaaagtcgaattccactgatgtgaaatgtcatttctgtagtagtg |
32212942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 251
Target Start/End: Original strand, 24168198 - 24168278
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||| |||||||| | || | ||||||||||| || |||||| || ||||||||||||||||||| | |||||| |
|
|
| T |
24168198 |
catcacctttcgttacatctggtgggacccgatgtgaaaagttgatttccactgatgtgaaatgtcatttctatagtagtg |
24168278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 24700175 - 24700097
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24700175 |
tcacctttagttacatcggttggaaaccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgtagtagtg |
24700097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 8486043 - 8485965
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
8486043 |
tcacccttagttacatcggttggtacccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttttgtagtagtg |
8485965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 173 - 249
Target Start/End: Original strand, 27237964 - 27238040
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtag |
249 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||| ||| |||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
27237964 |
tcacccttagttacatcggttgccacctgatgttaaaagtcgatttcaaccgatgtaagatgtcatttctgtagtag |
27238040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 54737231 - 54737170
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatg |
234 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54737231 |
tcacccttagttacatcggttggtacccgatgtgaaatgtcgatttcaaccgatgtaaaatg |
54737170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 47425146 - 47425224
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||| ||||||| || | ||||||||||| || |||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
47425146 |
tcacctttagtcacatcggctgggacccgatgtgaaaagttgatttccactgatgtgaaatgtcatttctgtagtagtg |
47425224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 32834666 - 32834615
Alignment:
| Q |
200 |
cgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
32834666 |
cgatgtgaaaagtcgattttgaccgatgtgaaatgtcatttctgtagtagtg |
32834615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 25574666 - 25574710
Alignment:
| Q |
207 |
aaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
25574666 |
aaatgtcgatttccactgatgtgaaatgtcatttctgtagtagtg |
25574710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 46225120 - 46225068
Alignment:
| Q |
199 |
ccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||||| ||||| | |||| ||||||||||||| ||| |||||| |
|
|
| T |
46225120 |
ccgatgtgaaatgtcaatttccatcgatatgaaatgtcatttatgtagtagtg |
46225068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 4e-26; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 179 - 251
Target Start/End: Complemental strand, 17042270 - 17042198
Alignment:
| Q |
179 |
ttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17042270 |
ttagttacatcggttggcacccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgtagtagtg |
17042198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 171 - 250
Target Start/End: Complemental strand, 7933486 - 7933407
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagt |
250 |
Q |
| |
|
||||| ||||||| ||||||||| | |||||||||||| |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
7933486 |
catcatctttagtgacatcggttaggacccgatgtgaaatatcgattccaaccgatgtgaaatgtcatttctgtagtagt |
7933407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 250
Target Start/End: Original strand, 34702904 - 34702982
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagt |
250 |
Q |
| |
|
|||| |||||||||||||||| || | ||||||||||| ||| || | | | ||||||||||||||||||||||||||| |
|
|
| T |
34702904 |
catcgcctttagttacatcggctgggaaccgatgtgaaaagtcaatatta-cagatgtgaaatgtcatttctgttgtagt |
34702982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 63 - 111
Target Start/End: Original strand, 34693346 - 34693394
Alignment:
| Q |
63 |
ttttaatccaagacattaaagacctcatctctcaaaccaatgtctctat |
111 |
Q |
| |
|
||||| ||||| | |||||||||||||||||||||| ||||||||||| |
|
|
| T |
34693346 |
ttttagtccaaaatattaaagacctcatctctcaaaataatgtctctat |
34693394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 4e-23; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 173 - 252
Target Start/End: Complemental strand, 19178030 - 19177952
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtgg |
252 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19178030 |
tcacctttaattacatcggttggta-ccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgtagtagtgg |
19177952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 251
Target Start/End: Complemental strand, 28239375 - 28239295
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||| |||||||||| | ||||||||||||||| ||||| || ||||||||||||||||| ||| |||||| |
|
|
| T |
28239375 |
catcacctttagtgacatcggttgggacccgatgtgaaatgtcaatttccactgatgtgaaatgtcatttatgtagtagtg |
28239295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 242
Target Start/End: Complemental strand, 12815053 - 12814983
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtg-aaatgtcgatttcaaccgatgtgaaatgtcatttct |
242 |
Q |
| |
|
||||||||||||||||||| || || |||||||| ||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
12815053 |
tcacctttagttacatcgggtgtcacccgatgtgaaaaagtcgatttcaagtgatgtgaaatctcatttct |
12814983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 5155580 - 5155502
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
5155580 |
tcacctttagttacatcggttgggacccgatgtgaaatgtcgatttccactgatgtgaaatgtcatttctgtagtagtg |
5155502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 171 - 251
Target Start/End: Complemental strand, 17722373 - 17722293
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||| ||| || ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17722373 |
catcacctttaggtacatcggttggcacccgatgttaaaagttgatttcaaccgatgtgaaatgtcatttctgtagtagtg |
17722293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 51746198 - 51746276
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||| |||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
51746198 |
tcacctttagttacatcggtagggacccgatgtgaaaagtcgttttccaccgatgtgaaatgtcatttctgtagtagtg |
51746276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 2594526 - 2594448
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||| ||||| ||| || ||||||||||||||||||||| |||||| |
|
|
| T |
2594526 |
tcacctttagttacatcggttgggacccgatgtaaaaagtcgaattccactgatgtgaaatgtcatttctgtagtagtg |
2594448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 251
Target Start/End: Complemental strand, 17641425 - 17641348
Alignment:
| Q |
174 |
cacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||| ||| |||||||||||| ||||||||| ||| |||||| |
|
|
| T |
17641425 |
cacctttagtgacatcggttaggacccgatgtgaaatgtcaattccaaccgatgtgagatgtcatttatgtagtagtg |
17641348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 183 - 251
Target Start/End: Complemental strand, 1979459 - 1979391
Alignment:
| Q |
183 |
ttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||| || ||||||||||| || ||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
1979459 |
ttacatcggttgtcaaccgatgtgaaaaatcattttcaactgatgtgaaaaatcatttctgctgtagtg |
1979391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0234 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0234
Description:
Target: scaffold0234; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 6945 - 7023
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||||||||| ||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
6945 |
tcacccttagttacatcggttggtacccgatgtgaaatgtcaatttcaatcgatgtgaaatgtcatttctgtagtagtg |
7023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 179 - 244
Target Start/End: Complemental strand, 16548357 - 16548292
Alignment:
| Q |
179 |
ttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgt |
244 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16548357 |
ttagttacatcggttggtacccgatgtgaaatgtcgatttcaactaatgtgaaatgtcatttctgt |
16548292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 250
Target Start/End: Original strand, 16730436 - 16730513
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagt |
250 |
Q |
| |
|
||||||||||||||||||| || | || |||||||| ||||||||| || ||||| ||||||||||||||| ||||| |
|
|
| T |
16730436 |
tcacctttagttacatcggctgggacccaatgtgaaaagtcgatttccactgatgttaaatgtcatttctgtagtagt |
16730513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 21224629 - 21224552
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||| ||||||| || | ||||||||||| ||||||||| || ||||| ||||||||||||||| |||||| |
|
|
| T |
21224629 |
tcacctttagt-acatcgggtgggacccgatgtgaaaagtcgatttccactgatgttaaatgtcatttctgtagtagtg |
21224552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 27966300 - 27966368
Alignment:
| Q |
183 |
ttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||||| | ||||||||| || | ||||||| ||||||||| | |||||||| |||||| |
|
|
| T |
27966300 |
ttacatcggttgccacctgatgtgaaaagtagttttcaactgatgtgaaaacttatttctgtagtagtg |
27966368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 8981625 - 8981547
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||| |||||| |||| | ||||||||||| ||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
8981625 |
tcacctttagctacatccgttgggacccgatgtgaaaagtcgattccaaccgatgtggaatgtcatttctgtagtagtg |
8981547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 173 - 253
Target Start/End: Complemental strand, 7706012 - 7705932
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtgga |
253 |
Q |
| |
|
||||||||||| ||||||| || | ||||||||||||||| ||||| || |||||||||||| |||||||| |||||||| |
|
|
| T |
7706012 |
tcacctttagtcacatcggctgggacccgatgtgaaatgtcaatttccactgatgtgaaatgtgatttctgtagtagtgga |
7705932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 31715307 - 31715385
Alignment:
| Q |
173 |
tcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||| ||||| || || ||||||||||||||||| ||| |||||| |
|
|
| T |
31715307 |
tcacctttagttacatcggttgggatccgatgtgaaaagtcgaatttcactgatgtgaaatgtcatttttgtagtagtg |
31715385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 251
Target Start/End: Complemental strand, 26263138 - 26263058
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||||||||||| || | || |||||||| ||||||||| || |||||||||| |||||| ||| |||||| |
|
|
| T |
26263138 |
catcacctttagttacatcgggtgggacccaatgtgaaaagtcgatttccactgatgtgaaatttcatttatgtagtagtg |
26263058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 251
Target Start/End: Complemental strand, 32913770 - 32913690
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||||||||||| || | ||||| ||||| ||||| ||| || |||||||||||||||||||| |||||| |
|
|
| T |
32913770 |
catcacctttagttacatcgggtgggatccgatttgaaaagtcgaattccactaatgtgaaatgtcatttctgtagtagtg |
32913690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 251
Target Start/End: Complemental strand, 21112819 - 21112740
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||| ||||||| || | ||||||||||| || |||||| || ||||| ||||||||||||||| |||||| |
|
|
| T |
21112819 |
catcacctttagtgacatcgggtggga-ccgatgtgaaaagttgatttccactgatgttaaatgtcatttctgtagtagtg |
21112740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 251
Target Start/End: Complemental strand, 21117562 - 21117482
Alignment:
| Q |
171 |
catcacctttagttacatcggttgccagccgatgtgaaatgtcgatttcaaccgatgtgaaatgtcatttctgttgtagtg |
251 |
Q |
| |
|
||||||||||||| ||||||| || | ||||||||||| || |||||| || ||||| |||| |||||||||| |||||| |
|
|
| T |
21117562 |
catcacctttagtgacatcgggtgggacccgatgtgaaaagttgatttccactgatgttaaatatcatttctgtagtagtg |
21117482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University