View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17660_high_29 (Length: 322)
Name: NF17660_high_29
Description: NF17660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17660_high_29 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 4201153 - 4201100
Alignment:
| Q |
269 |
tagggtttagttcatattcaattttgttcaattcaattgaattcgattttcaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4201153 |
tagggtttagttcatattcaattttgttcaattcaattgaattcgattttcaat |
4201100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 4201258 - 4201211
Alignment:
| Q |
165 |
gacctcttttaatttccaaatcttcttcc-tttctcgtcttctgcaac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4201258 |
gacctcttttaatttccaaatcttcttccttttctcgtcttctgcaac |
4201211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University