View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17661_high_63 (Length: 209)

Name: NF17661_high_63
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17661_high_63
NF17661_high_63
[»] chr5 (1 HSPs)
chr5 (28-88)||(41343347-41343407)
[»] chr2 (1 HSPs)
chr2 (156-192)||(18744997-18745033)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 28 - 88
Target Start/End: Original strand, 41343347 - 41343407
Alignment:
28 gtgacttacaattctcttgctaaattcaatccctgccaccacaaaaggtgtaatcccagct 88  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41343347 gtgacttacaattctcttgctaaattcaatccctgccaccacaaaaggtgtaatcccagct 41343407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 192
Target Start/End: Original strand, 18744997 - 18745033
Alignment:
156 ttttataccatttgctttcgacattttcgattttcta 192  Q
    |||||||||||||||||| ||||||||||||||||||    
18744997 ttttataccatttgcttttgacattttcgattttcta 18745033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University