View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_10 (Length: 453)
Name: NF17661_low_10
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 1e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 42117901 - 42118109
Alignment:
| Q |
1 |
tctattttaagttctaatgaaaagatttataa-aggagaatcttagttagcttgtaagcactatcaaattcttttaatgtattattactttatcaattag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
42117901 |
tctattttaagttctaatgaaaagatttataataggagaatcttagttagcttgtaagc-ctatcaaattcttttaatattgtattactttatcaattag |
42117999 |
T |
 |
| Q |
100 |
tagaagttatgaaataaacccaaatatagaaaacaacaaccacagccagcgatgataacttgtgtttattccacactcaagtcaagagaaattgcataaa |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42118000 |
tagaacttatgaaataaacccaaatatagaaaacaacaaccacaggcagcgatgataactcgtgtttattccacactcaagtcaagagaaattgcataaa |
42118099 |
T |
 |
| Q |
200 |
caacacaata |
209 |
Q |
| |
|
|||| ||||| |
|
|
| T |
42118100 |
caacgcaata |
42118109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University