View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_33 (Length: 300)
Name: NF17661_low_33
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 20 - 290
Target Start/End: Complemental strand, 45934649 - 45934379
Alignment:
| Q |
20 |
ctgggaacatatcgcctattgatgtcatcactcatgttccaattttatgcgaggataaggacattccatatgtatatgtctcatctaaagaagtaagtaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934649 |
ctgggaacatatcgcctattgatgtcatcactcatgttccgattttatgcgaggataaggacattccatatgtatatgtctcatctaaagaagtaagtaa |
45934550 |
T |
 |
| Q |
120 |
ccaactttgcgctgaatcttgatgctttttatcatttagttaatactattgactgcctgtttccctaatctctctttagaataaggaaaatttgttgtca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934549 |
ccaactttgcgctgaatcttgatgctttttatcatttagttaatactattgactgcctgttttcctaatctctctttagaataaggaaaatttgttgtca |
45934450 |
T |
 |
| Q |
220 |
tacatatagcctgatgttaatttgatgtcataaataactaaaagttgaggctttttcctcattgatgatgt |
290 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934449 |
tatacatagcctgatgttaatttgatgtcataaataactaaaagttgaggctttttcctcattgatgatgt |
45934379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University