View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_36 (Length: 287)
Name: NF17661_low_36
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 42114940 - 42114682
Alignment:
| Q |
19 |
tctcctccatctaaaacaactccattctcttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaacaccagcctcaagtataaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42114940 |
tctcctccatctaaaacaactccattctcttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaacaccagcctcaagtataaca |
42114841 |
T |
|
| Q |
119 |
ggttcatgctcttgctttaatatgtttataagacaaaactgcatcagtgtccttttaacttttcaattaagtcctttgtttatttttcgtgccaaattag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42114840 |
ggttcatgctcttgctttaatatgtttataagacaaaactgcatcagtgtccttttaacttttcaattaagtcctttgtttatttgtcgtgccaaattag |
42114741 |
T |
|
| Q |
219 |
tcgtcgacttttaataatgtttagactgctgaaccgattttcattactgtccccctatg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42114740 |
tcgtcgacttttaataatgtttagactgctgaaccgattttcattactgtccccttatg |
42114682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 98
Target Start/End: Complemental strand, 26450081 - 26450014
Alignment:
| Q |
31 |
aaaacaactccattctcttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| ||||||||| ||||||| || |||||||| |
|
|
| T |
26450081 |
aaaacaactccattctcttctatacttgcatttggtgttgttatggcctttgcatgtgtccttgcaaa |
26450014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University