View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_39 (Length: 279)
Name: NF17661_low_39
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 11 - 261
Target Start/End: Complemental strand, 52726105 - 52725855
Alignment:
| Q |
11 |
cagagacccacacatataatttctaagacgtgaaactttaagttgtttcaaggcgggccaagcatgaagattttgattgtcactcttaaagggtatcatc |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52726105 |
cagagacccacacatatgatttctaagacgtgaaactttaagttgtttcaaggcgggccaagcatgaagattttgattgtcactctcaaagggtatcatc |
52726006 |
T |
 |
| Q |
111 |
atcatcatttcggttggattcaatcaatatctctaatttctcatcattgcacatgtttaacgacatttacttaatcaggtgcatgaatctcaagcacaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52726005 |
atcatcatttcggttggattcaatcaatatctctaatttctcatcattgcacatgtttaacgacatttacttaatcaggtgcatgaatctcaagcacaaa |
52725906 |
T |
 |
| Q |
211 |
aagtacaaaactaactatagctaattgtgtttgaaacgaccagcaagatag |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725905 |
aagtacaaaactaactatagctaattgtgtttgaaacgaccagcaagatag |
52725855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University