View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_46 (Length: 251)
Name: NF17661_low_46
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 44801674 - 44801453
Alignment:
| Q |
18 |
aatgtctacggctataagttgattagaatatgaactagtgaaccggacaaactaaaccaatctaatatgtaaaatacaacgagcactatgcaaatagnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801674 |
aatgtctacggctataagttgattaga---tgaactagtgaaccggacaaactaaaccaatctaatatgtaaaatacaacgagcactatgcaaatagttt |
44801578 |
T |
 |
| Q |
118 |
nnnnaattaaattgtagtaaaatttatgtcttacatatgtgatggtnnnnnnnngtccactttcacacggtccctttcataagaaaccatctctctcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801577 |
ttttaattaaattgtagtaaaatttatgtcttacatatgtgatggtaaaaaaaagtccactttcacacggtccctttcataagaaaccatctctctcaaa |
44801478 |
T |
 |
| Q |
218 |
cacttagaaaccctaactttcatct |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44801477 |
cacttagaaaccctaactttcatct |
44801453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University