View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_54 (Length: 238)
Name: NF17661_low_54
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_54 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 36148065 - 36148286
Alignment:
| Q |
17 |
aaactcattatctggttttctggaccgagttccgtttagtctacgacgctgggcatgttacccaatgctacttggtcgtgttcgacgcaacttcaaacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36148065 |
aaactcattatctggttttctggaccgagttccgtttagtctacgacgctgggcatgttacccaatgctacttggtcgtgttcgacgcaacttcaaacac |
36148164 |
T |
|
| Q |
117 |
gtgatgcttgtagacacaaaaacaattctcattcttcgtgacccgtttaaccgagtcaagaatcggagtccagaatcggttttactcttcaacaaacacg |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36148165 |
gtgatgcttttagacacaaaaacaattctcattcttcgtgacccgtttaaccgagtcaagaatcggagtccagaatcggttttactcttcaacaaacacg |
36148264 |
T |
|
| Q |
217 |
gaaaaaagattcagtcaagcac |
238 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
36148265 |
gaaaaaagcttcagtcaagcac |
36148286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University