View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_60 (Length: 223)
Name: NF17661_low_60
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_60 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 41 - 223
Target Start/End: Complemental strand, 1384291 - 1384111
Alignment:
| Q |
41 |
tttctcaatcatttaggcatagaaacatgctaaagtgcaagatatattattttaccaaaacatggtagagtacatgataattggggggaggaattgcctt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1384291 |
tttctcaatcatttaggcatagaaacatgctaaggtgcaagatat--tattttaccaaaacaaggtagagtacatgataattggggggaggaattgcctt |
1384194 |
T |
|
| Q |
141 |
tactgcttaatcccatcaaacaaccaatcttgaattttgtcgaaattatgactatatttttctaagtgtgcacacaagcacat |
223 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1384193 |
tactgcttattcccatcaaacaaccaatcttgaattttgtcgaaattatgactatatttttctaagtgtgcacacaagcacat |
1384111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 134 - 223
Target Start/End: Complemental strand, 1366784 - 1366696
Alignment:
| Q |
134 |
ttgcctttactgcttaatcccatcaaacaaccaatcttgaattttgtcgaaattatgactatatttttctaagtgtgcacacaagcacat |
223 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
1366784 |
ttgcctttactactttatcccatcaaacaaccaatcttgaattttgtcaaaattatggctatatttttct-agtgtgtacacaagcacat |
1366696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 223
Target Start/End: Original strand, 1171623 - 1171686
Alignment:
| Q |
159 |
aacaaccaatcttgaattttgtcgaaattatgactatatttttctaagtgtgcacacaagcacat |
223 |
Q |
| |
|
||||||||||||||||||||| | ||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
1171623 |
aacaaccaatcttgaattttgaggtaattatggctatatttttct-agtgtgcacacaagcacat |
1171686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 101
Target Start/End: Complemental strand, 1367249 - 1367191
Alignment:
| Q |
41 |
tttctcaatcatttaggcatagaaacatgctaaagtgcaagatatattattttaccaaaac |
101 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| |||||||| |||||||||||| ||||| |
|
|
| T |
1367249 |
tttctcaattatttaggcatagaaacattctagagtgcaag--atattattttactaaaac |
1367191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University