View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_61 (Length: 220)
Name: NF17661_low_61
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_61 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 27161968 - 27161780
Alignment:
| Q |
15 |
aatataatcacatatatcttgtaaccaagcaagtttatgaattcacggtgcatccaattaccccttagcatgatgaatcttaatcttgttctcacaacct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27161968 |
aatataatcacatatatcttgtaaccaag----tttatgaattcacggtgcatccaattaccccttagcatgatgaatcttaatcttgttctcacaacct |
27161873 |
T |
 |
| Q |
115 |
tctataa---gtcccttcaagatcctacaacaccacaaatatttatcaataaagggaagaggaagaaaatattgaagaaacgatgtcacaatt |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27161872 |
tctataataagtcccttcaagatcctacaacaccacaaatatttattaataaagggaagaggaagaaaatattgaagaaacgatgtcacaatt |
27161780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University