View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_62 (Length: 217)
Name: NF17661_low_62
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 200
Target Start/End: Complemental strand, 44135904 - 44135716
Alignment:
| Q |
12 |
tcatcgtttaactaatttaacaaagtatcatgtttctagtaacatacgtgggacctcaacgtataactatttagagcgattaaacataatgtgtaacctc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
44135904 |
tcatcgtttaactaatttaacaaagtatcatgtttctagtcacacacgtgggacctcaacatataactatttagagcgattaaacataatgtgtaatcgc |
44135805 |
T |
 |
| Q |
112 |
tctaaagagcctttgttgatttgtttcatattataatttattgaaataaaatcaattgatgtgttttcaggataataatacaagtgtga |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44135804 |
tctaaggagcctttgttgatttgtttcatattataatttattgaaataaaatcaattgatgtgttttcaggataataatatgagtgtga |
44135716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University