View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_67 (Length: 210)
Name: NF17661_low_67
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 1241051 - 1240870
Alignment:
| Q |
18 |
gtctcatattccaaattgttggaatgttttcttttttgattcaaacaacgttagctagctagnnnnnnngtccttttatgcatccaactgtcactgttcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1241051 |
gtctcatattccaaattgttggaatgttttcttttttgattcaaacaacgttagctagctagtttttttgtccttttatgcatccaactgtcactgttcc |
1240952 |
T |
|
| Q |
118 |
attcctactcttcagtacccttctttctactcaaagttagggcttttcaccaagttgcaggtaacaacatcacttcttctca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240951 |
attcctactcttcagtacccttctttctactcaaagttagggcttttcaccaagttgcaggtaacaacatcacttcttctca |
1240870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University