View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17661_low_69 (Length: 209)
Name: NF17661_low_69
Description: NF17661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17661_low_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 28 - 88
Target Start/End: Original strand, 41343347 - 41343407
Alignment:
| Q |
28 |
gtgacttacaattctcttgctaaattcaatccctgccaccacaaaaggtgtaatcccagct |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343347 |
gtgacttacaattctcttgctaaattcaatccctgccaccacaaaaggtgtaatcccagct |
41343407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 192
Target Start/End: Original strand, 18744997 - 18745033
Alignment:
| Q |
156 |
ttttataccatttgctttcgacattttcgattttcta |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18744997 |
ttttataccatttgcttttgacattttcgattttcta |
18745033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University