View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17662_low_22 (Length: 230)
Name: NF17662_low_22
Description: NF17662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17662_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 212
Target Start/End: Complemental strand, 4706727 - 4706528
Alignment:
| Q |
20 |
atgaaagataaagccgagaaacacgacaattttcaaaactatcaattccacataaacaagaaataaactttctaaagaaaaatttaattttactgaaaaa |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4706727 |
atgaaagataaagctgagaaacacgacaattttcaaaactatcaattccacataaacaagaaataaactttctaaagaaaaatttaattttactgaaaaa |
4706628 |
T |
 |
| Q |
120 |
ctctgattgcctctagatttattccaaatgaggaaaggcttggtattttctttctat-------taaaaagattaaaataaaggaaaaataacaaatttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4706627 |
ctctgattgcctctagatttattccaaatgaggaaaggcttggtattttctttctatcagctaaaaaaaagattaaaataaaggaaaaataacaaatttg |
4706528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University