View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17664_high_10 (Length: 343)
Name: NF17664_high_10
Description: NF17664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17664_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 326
Target Start/End: Complemental strand, 13293219 - 13292912
Alignment:
| Q |
16 |
attattataatgatttatgaatcattgaataagataccctaccaagcttggtcannnnnnnnnnnnaacaattattataaactcattagattttaggtat |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13293219 |
attattatgatgatttatgaatcattgaataagataccctaccaagctaggtcatttttttttt--aacaattattataaactcattagattttaggtat |
13293122 |
T |
 |
| Q |
116 |
catcatacaaagcacttatgcacgagatcttaagcatgttattattatataatcataatattatatgtgtgtttagttaattaccagcagatttagccaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13293121 |
catcatacaaagcacttatgcacgagatcttaagcatgttattattatata-tcataatattatatgtgtgtttagttaattaccagcagatttagccaa |
13293023 |
T |
 |
| Q |
216 |
ggagttccaaacaccttcaccatgattggcaatatagttgatcaagatcaagtcttcttccattgtccatggtccctttcgtacatcaggatcttgtgaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13293022 |
ggagttccaaacaccttcaccatgattggcaatatagttgatcaagatcaagtcttcttccattgtccatggtccctttcgtacatcaggatcttgtgaa |
13292923 |
T |
 |
| Q |
316 |
gaactgcactc |
326 |
Q |
| |
|
||||||||||| |
|
|
| T |
13292922 |
gaactgcactc |
13292912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 194 - 311
Target Start/End: Complemental strand, 969143 - 969026
Alignment:
| Q |
194 |
aattaccagcagatttagccaaggagttccaaacaccttcaccatgattggcaatatagttgatcaagatcaagtcttcttccattgtccatggtccctt |
293 |
Q |
| |
|
|||||||||||| ||| || ||||| ||||||||||||||||||||||| |||||||| ||||| || ||||||||||||||||| |||||||| || || |
|
|
| T |
969143 |
aattaccagcagctttggctaaggaattccaaacaccttcaccatgatttgcaatataattgattaaaatcaagtcttcttccatggtccatggcccttt |
969044 |
T |
 |
| Q |
294 |
tcgtacatcaggatcttg |
311 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
969043 |
tctcacttcaggatcttg |
969026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University