View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17664_high_17 (Length: 296)
Name: NF17664_high_17
Description: NF17664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17664_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 202 - 273
Target Start/End: Complemental strand, 8754209 - 8754138
Alignment:
| Q |
202 |
tatttctggaaagtagtcagtgagaactcattcaccaacagaaacatgacttcactgaattttttactgtaa |
273 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8754209 |
tatttctgcaaactagtcagtgggaactcattcatcaacaaaaacatgacttcactgaattttttgctgtaa |
8754138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 220 - 273
Target Start/End: Original strand, 10507236 - 10507289
Alignment:
| Q |
220 |
agtgagaactcattcaccaacagaaacatgacttcactgaattttttactgtaa |
273 |
Q |
| |
|
|||| ||||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10507236 |
agtgggaactcattcatcaacgaaaacatgatttcactgaattttttactgtaa |
10507289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 83
Target Start/End: Original strand, 13898039 - 13898083
Alignment:
| Q |
39 |
ttacctcaggaatgacagaaagaacaggaagaatgtcttgaatgg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13898039 |
ttacctcaggaatgacagaaagaacaggaagaatgtcttgaatgg |
13898083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 39 - 83
Target Start/End: Original strand, 13474836 - 13474880
Alignment:
| Q |
39 |
ttacctcaggaatgacagaaagaacaggaagaatgtcttgaatgg |
83 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13474836 |
ttacctcaggaatgacagaaagaacaagaagaatgtcttgaatgg |
13474880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 263
Target Start/End: Complemental strand, 14081952 - 14081904
Alignment:
| Q |
215 |
tagtcagtgagaactcattcaccaacagaaacatgacttcactgaattt |
263 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
14081952 |
tagtcagtgagaactcattcatcaacagaaacatgacttcattgaattt |
14081904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 268
Target Start/End: Original strand, 13475058 - 13475124
Alignment:
| Q |
202 |
tatttctggaaagtagtcagtgagaactcattcaccaacagaaacatgacttcactgaattttttac |
268 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||||| || | |||| |||||||||||||||||||||| |
|
|
| T |
13475058 |
tatttctgcaaagtagtcagtgtgaacttattcatcatcggaaaaatgacttcactgaattttttac |
13475124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 204
Target Start/End: Complemental strand, 14082025 - 14081978
Alignment:
| Q |
157 |
caatgcaatgacattcagatatttctacgcctgctcttatagcgttat |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
14082025 |
caatgcaatgacactcagatatttctacgcctgcagttatagcgttat |
14081978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 32 - 83
Target Start/End: Complemental strand, 14082836 - 14082785
Alignment:
| Q |
32 |
catagacttacctcaggaatgacagaaagaacaggaagaatgtcttgaatgg |
83 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
14082836 |
catagatttaccacaggaatgagagaaagaacaggaagaatgtcttaaatgg |
14082785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 79
Target Start/End: Original strand, 13894977 - 13895022
Alignment:
| Q |
34 |
tagacttacctcaggaatgacagaaagaacaggaagaatgtcttga |
79 |
Q |
| |
|
|||| |||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
13894977 |
tagatttacctcaggaatggcagaaagaacgggaagaatgtcttga |
13895022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 13475001 - 13475042
Alignment:
| Q |
163 |
aatgacattcagatatttctacgcctgctcttatagcgttat |
204 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
13475001 |
aatgacattcagatattgctatgcctgctgttatagcgttat |
13475042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University