View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17664_low_20 (Length: 268)
Name: NF17664_low_20
Description: NF17664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17664_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 40798181 - 40797963
Alignment:
| Q |
30 |
ttctcaattgatcttattgttgattaggagaaaacaaaaattga--acacaagttaaaaaagtagttcactacggttaacttccactatgacaatgacaa |
127 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40798181 |
ttctcaattgatcttactgttgattaggaaaaaacaaaaattgagaacacaagttaaaaaagtagttcactacggttaacttccactatgacaatgacaa |
40798082 |
T |
|
| Q |
128 |
ggtc-aaaaaaggttcaatgtctgtggaattattgtaaacagtcctgccttctggtcaaatatttacaactctacttattacgttgggttgggacttctt |
226 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
40798081 |
ggtccaaaaaaggttcaatgtctgcggaattattgtaaacagtcctgccttctgatcaaatatttacaactctacggattacgt-----tgggacttctt |
40797987 |
T |
|
| Q |
227 |
ctaaatgggctacctagtgttcta |
250 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
40797986 |
ctaaatggactacctagtgttcta |
40797963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 40798224 - 40798191
Alignment:
| Q |
1 |
caactttccctaagaagttccgtgcaactttctc |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40798224 |
caactttccctaagaagttccgtgcaactttctc |
40798191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University