View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17664_low_22 (Length: 253)
Name: NF17664_low_22
Description: NF17664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17664_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 13292653 - 13292858
Alignment:
| Q |
16 |
aatattgagagaacgtaaagataaaatatatatagcctctaacatgcatagtcatgcatgcatgttgatattagaaacatagttaggtacgtaaaaaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13292653 |
aatattgagagaacgtaaagataaaatatatatagcctctaacatgcatagtcatgcatgcatgttgatattagaaacatagttaggtacgtaaaaaagt |
13292752 |
T |
|
| Q |
116 |
tgaatttacaattaacaaatgatgttagtgttccctctatttaaacgctccaacccccattattatgatatgtcatgagcatatgtcttccttcatgtac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13292753 |
ggaatttacaattaacaaatgatgttagtgttccctctatttaaacgctccaacccccattattatgatatgtcatgagcatatgtcttccttcatgtac |
13292852 |
T |
|
| Q |
216 |
actact |
221 |
Q |
| |
|
|||||| |
|
|
| T |
13292853 |
actact |
13292858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University