View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17664_low_27 (Length: 232)
Name: NF17664_low_27
Description: NF17664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17664_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 51 - 215
Target Start/End: Complemental strand, 33766193 - 33766029
Alignment:
| Q |
51 |
gcatcttaatgaattaagccattaatgtatgaacataatgaatgaaaatatacaaatcatatcaacaagattgttgatgaattaaatgaggtttatgata |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33766193 |
gcatcttaatgaattaagccattaatgtatgaacataatgaatgaaaatatacaaatcatatcaacaagattgttgatgaattaaatgaggtttatgata |
33766094 |
T |
 |
| Q |
151 |
aaaatgtttaggtatatacctagagggttagaaggggcagaatgggcaaggagagggacagtgac |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33766093 |
aaaatgtgtaggtatatacctagagggttagaaggggcagaatgggcaaggagagggacagtgac |
33766029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University