View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17665_high_2 (Length: 274)
Name: NF17665_high_2
Description: NF17665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17665_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 15 - 265
Target Start/End: Original strand, 51767143 - 51767388
Alignment:
| Q |
15 |
agaaggggtttgagagcaaattgggcgagtcttggacgaccaaaggtccaaattgtgtggcaaannnnnnnggtaggcttccaactcgtggtagcctttg |
114 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
51767143 |
agaagaggtttgagagcaaattgggcaagtcttggacgaccaaaggtccaaattgtgtggcaaatttttttt-taggcttccaactcgtggttgcctttg |
51767241 |
T |
 |
| Q |
115 |
aactaagggtatccttagaggcgggccatactaagaatatgtgtttggtgtctgtgagtgagttcaaaacatcgaggaacacttggtttgtatttgtgat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||| |||||||||||||||| ||||||| |
|
|
| T |
51767242 |
aactaagggtatccttagaggcgggccatactaagaatatgtgtttggtgtctgtgagt----ttaagacatcgaagaacacttggtttgtacttgtgat |
51767337 |
T |
 |
| Q |
215 |
ttcaccatctcaatgtgatatcagttgttttcattggtgggctccgatatt |
265 |
Q |
| |
|
||||| || |||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
51767338 |
ttcactatttcaatgtgatattagttgttttcattggtgggcaccgatatt |
51767388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University