View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17665_low_3 (Length: 268)
Name: NF17665_low_3
Description: NF17665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17665_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 35703277 - 35703026
Alignment:
| Q |
17 |
agttttcaatgcacaagtagttaaatcgctaaatggaagagctcactacacctgcttcatacaccttagttgagtttacatttacaaaattaaattaaa- |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35703277 |
agttttcaatgcacaagtagttaaatcgctaaatggaagagctcactacacctgcttcatacaccttagttgagtttacatttacaaaattaaattaaat |
35703178 |
T |
|
| Q |
116 |
----ttaaggcaccataattcttc-----------ttcttgtttttgtgcgaccaaacaattacatacagcagaagatctgcatggttgcaaaagcttga |
200 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||| | |
|
|
| T |
35703177 |
taaattaaggcaccagaattcttctcactttagatttcttatttttgtgcaaccaaacaattacatagagcagaagacctgcatggttgcaaaagcttca |
35703078 |
T |
|
| Q |
201 |
aatgataaaaggaattgaggtgtctaacctgctaggatagtaggagatgcca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35703077 |
aatgataaaaggaattgaggtgtctaacctgctaggatagtaggagatgcca |
35703026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 136 - 252
Target Start/End: Complemental strand, 7956881 - 7956765
Alignment:
| Q |
136 |
ttcttgtttttgtgcgaccaaacaattacatacagcagaagatctgcatggttgcaaaagcttgaaatgataaaaggaattgaggtgtctaacctgctag |
235 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||| || ||||||||||| ||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
7956881 |
ttcttgtttttgtgacaccaaacaattacatacagtagaggacctgcatggttgataaagcttcaaatgatagcaggaattgaggtgtctaacctgctag |
7956782 |
T |
|
| Q |
236 |
gatagtaggagatgcca |
252 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
7956781 |
gatagtaggaaatgcca |
7956765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University