View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17666_low_5 (Length: 236)
Name: NF17666_low_5
Description: NF17666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17666_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 24159856 - 24159639
Alignment:
| Q |
1 |
ttcatcatgatattctaaaaggaagcaaggtctctacttgagggaagttataaggaaacttcattttcgaaaatgggtttttagctagaattagctggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
24159856 |
ttcatcatgatattctaaaaggaagcaaggtctctacttgagggaagttataaggaaacttcattttcgaaa-tgggtttt-agctagaattagctggac |
24159759 |
T |
|
| Q |
101 |
cttatggaatttggttcacttcctctagtaaaaaa-gtatatgtgtgaagatgtaaagtcgtgaacacgagttgaaacatcttagactaactctttgcag |
199 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24159758 |
cttatggaatttagt-cacttc-tctagtaaaaaaagtacatgtgtgaagatgtaaagtcgtgaacacgagttgaaacatcttagactaactccttgcag |
24159661 |
T |
|
| Q |
200 |
agttgaatttttaggattattt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24159660 |
agttgaatttttaggattattt |
24159639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University