View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17667_high_5 (Length: 354)
Name: NF17667_high_5
Description: NF17667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17667_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 61 - 333
Target Start/End: Original strand, 31541573 - 31541835
Alignment:
| Q |
61 |
gaaggagtgtaaattgtaattgtaatatgaatagaggtggatcatggaccaatatatatatnnnnnnnnnnnnnnnnnngatgatcttaaattaattatt |
160 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31541573 |
gaaggaatgtaaattgcaattgtaatatgaatagaggtggatcatggaccaatatatatataaaaaaa-----------gatgatcttaaattaattatt |
31541661 |
T |
 |
| Q |
161 |
aacgaggttgaaccc-ttttcaagctactgttcccattagcactattgttaacacttaacagagtataccatcaactattataggctgtaaagagagagc |
259 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31541662 |
aacgaggttgaaccccttttcaagccactgttcccattagcattattgttaacacttaacagagtataccatcaactattataggctgtaaagagagaac |
31541761 |
T |
 |
| Q |
260 |
aacaatataatgcgatcaaagatcacttaatttgattacttttcccatcaaatttttcatgaaaaatctaagag |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31541762 |
aacaatataatgcgatcaaagatcacttaatttgattgcttttcccatcaaatttttcatgaaaaatctaagag |
31541835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University