View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17667_high_9 (Length: 327)
Name: NF17667_high_9
Description: NF17667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17667_high_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 10 - 327
Target Start/End: Complemental strand, 32164819 - 32164502
Alignment:
| Q |
10 |
atatgaaagctcaatgagttattattgactctcgagctagacaatcttgcttctaccacaaggccatttactaactctgctgatcttttggtcactttac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164819 |
atatgaaagctcaatgagttattattgactctcgagctagacaatcttgcttctactacaaggccatttactaactctgctgatcttttggtcactttac |
32164720 |
T |
 |
| Q |
110 |
ctcctcggacccatcagctcctgccaagctcttcgattcttatgcctgaacggttatctccagctttacaagactcaatttcagaacatgcacatctgcg |
209 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
32164719 |
ctcctcgaacccatcagcttctgccaagctcttcgaatcttatgcctgaacggttatctccagctttacaagactcattttcagaacatgcacatctccg |
32164620 |
T |
 |
| Q |
210 |
gtagggtgattataaaaccagtccagctgcttgttaagaaggtaatttttctttatgatcacacacgatcatgaaaaaagtagatatgatcaaactgcca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32164619 |
gtagggtgattataaaaccagtccagctgcttgttaagaaggtaatttttctttatgatcacacacgatcatgagcaaagtagatatgatcaaactgcca |
32164520 |
T |
 |
| Q |
310 |
cattgacatgtgtagtat |
327 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32164519 |
cattgacatgtgtagtat |
32164502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University