View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17668_high_25 (Length: 428)
Name: NF17668_high_25
Description: NF17668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17668_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 6e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 44916278 - 44916379
Alignment:
| Q |
17 |
aattttgcttccaacactaccaatgaagctccaatgaaatcagtataaccaaaaggtttgctattatgtaactgtgatgtgagactaaatgagtttcaca |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44916278 |
aattttgcttccaacacta---atgaagctccaatgaaatcagtataaccaaaaggtttgctattatgtaactgtgatgtgagactaaatgagtttcaca |
44916374 |
T |
 |
| Q |
117 |
gcaat |
121 |
Q |
| |
|
||||| |
|
|
| T |
44916375 |
gcaat |
44916379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University