View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17668_high_47 (Length: 268)

Name: NF17668_high_47
Description: NF17668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17668_high_47
NF17668_high_47
[»] chr8 (1 HSPs)
chr8 (13-252)||(39641498-39641737)


Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 39641498 - 39641737
Alignment:
13 cacagacaaatgagcaatcagaggccttagaaaaggttttagataagtattcgagatgcttcaaattcaatattccaaaggggtggcacaaggccttgac 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39641498 cacagacaaatgagcaatcagaggccttagaaaaggttttagataagtattcgagatgcttcaaattcaatattccaaaggggtggcacaaggccttgac 39641597  T
113 ctgggccaagtattggtataataataacaccctttcgaacaagcatatccacgactccgatcaaaattactcagatatacacctaacctaaatgattcac 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39641598 ctgggccaagtattggtataataataacaccctttcgaacaagcatatccacgactccgatcaaaattactcagatatacacctaacctaaatgattcac 39641697  T
213 atgaaattcaggagcaacttactcacatagatgtggttta 252  Q
    ||||||||||||||||||||||||||||||||||||||||    
39641698 atgaaattcaggagcaacttactcacatagatgtggttta 39641737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University