View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17668_high_54 (Length: 228)
Name: NF17668_high_54
Description: NF17668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17668_high_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 23 - 205
Target Start/End: Original strand, 35183397 - 35183579
Alignment:
| Q |
23 |
acataatactttctctacacttccaatgcaaaggtatctactgttctcatcctcgtaacgcacatgattaattgcaatttctaatgccttctgtctaagc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35183397 |
acataatactttctctacacttccaatgcaaaggtatctactgttctcatcctcgtaacccacatgattaattgcaatttctaatgccttctgtctaagc |
35183496 |
T |
 |
| Q |
123 |
ttggtgaaaggccagcaattcagaaaaggctctcccacgtgataaagaaatccccataacatatcttgaatcataggatgtgg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35183497 |
ttggtgaaaggccagcaattcagaaaaggctctcccacgtgataaagaaatccccataacatatcttgaatcataggatgtgg |
35183579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 69 - 192
Target Start/End: Original strand, 12295250 - 12295373
Alignment:
| Q |
69 |
tcatcctcgtaacgcacatgattaattgcaatttctaatgccttctgtctaagcttggtgaaaggccagcaattcagaaaaggctctcccacgtgataaa |
168 |
Q |
| |
|
|||||||| ||||| | |||||| |||||||||| ||||| | ||||||||||| | ||||||||| ||||||| ||||||||||| || ||||||| |
|
|
| T |
12295250 |
tcatcctcataacgtatatgatttattgcaatttgtaatgaactatgtctaagcttcgaaaaaggccagtaattcagcaaaggctctccaacatgataaa |
12295349 |
T |
 |
| Q |
169 |
gaaatccccataacatatcttgaa |
192 |
Q |
| |
|
| || ||||||| ||||| ||||| |
|
|
| T |
12295350 |
gcaacccccataccatatattgaa |
12295373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University