View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17668_high_55 (Length: 226)
Name: NF17668_high_55
Description: NF17668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17668_high_55 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 226
Target Start/End: Original strand, 38266663 - 38266873
Alignment:
| Q |
15 |
cataggcaatattaggccagaccaaattactgatgggacagtgttttggtaactcagcaacagctgagactattgggccacaaagtggaaatggacttgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38266663 |
cataggcaatattaggccagaccaaattactgatgggacagtgttttggtaactcagcaacaactgagactattgggccacaaagtggaaatggacttgg |
38266762 |
T |
 |
| Q |
115 |
ggttagcaggccctaaaataacaaaaaagaccccaacttgaggatatgagtcatcttctctatgctcttgcatttttgtttcatgcttttggttagaata |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38266763 |
ggttagc-ggccctaaaataacaaaaaagaccccaacttgaggatatgagtcaccttttctatgctcttgcatttttgtttcatgcttttggttagaata |
38266861 |
T |
 |
| Q |
215 |
ttctctattctg |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38266862 |
ttctctattctg |
38266873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 38266862 - 38266904
Alignment:
| Q |
170 |
ttctctatgctcttgcatttttgtttcatgcttttggttagaa |
212 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
38266862 |
ttctctattctgttgcatttttgtttcatgcttttggttagaa |
38266904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University