View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17668_high_59 (Length: 209)
Name: NF17668_high_59
Description: NF17668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17668_high_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 123 - 187
Target Start/End: Complemental strand, 38195591 - 38195527
Alignment:
| Q |
123 |
ttaagtttagtctaagtttaatcttattttacttttatagtgactaaatataaaactaaaaacta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38195591 |
ttaagtttagtctaagtttaatcttattttgcttttatagtgactaaatataaaactaaaaacta |
38195527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 38195814 - 38195761
Alignment:
| Q |
1 |
ttacattttcgcataaaattcttcctgttttcaagatgagcgtataattctttc |
54 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38195814 |
ttacattttcgcataaaattcttcttgttttcaagatgagcgtataattctttc |
38195761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 114
Target Start/End: Complemental strand, 38195613 - 38195583
Alignment:
| Q |
84 |
ttccctatgaagttcactacttttaagttta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38195613 |
ttccctatgaagttcactacttttaagttta |
38195583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University