View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17668_low_38 (Length: 343)
Name: NF17668_low_38
Description: NF17668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17668_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 92 - 324
Target Start/End: Complemental strand, 37002113 - 37001881
Alignment:
| Q |
92 |
gggaaatttttgcagtttcgataaattgatggattagagcaacatcgtcttataaattcatgtagtagaatagtttattgttatcaaattatgacacctc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37002113 |
gggaaatttttgcagtttcgataaattgatggattagagcaacatcgtcttatacattcatgtagtagaatagtttattgttatcaaattatgacaccgc |
37002014 |
T |
 |
| Q |
192 |
tgagttagaaacttgataattaagaaacaaaattgacaaaatgaaatttcatgatcagaagaaatctaagaaagtaggtagtgtcatagtggtaccttag |
291 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002013 |
tgagttagaaagttcataattaagaaacaaaattgacaaaatgaaatttcatgatcagaagaaatctaagaaagtaggtagtgtcatagtggtaccttag |
37001914 |
T |
 |
| Q |
292 |
catgttgaggttcagaaacatcttgataaacac |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37001913 |
catgttgaggttcagaaacatcttgataaacac |
37001881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University