View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17668_low_57 (Length: 234)
Name: NF17668_low_57
Description: NF17668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17668_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 21329259 - 21329058
Alignment:
| Q |
17 |
cagactccagctgaggtttgtgtttagtggcatctgttcatcgtttaactttgaaagttgttattggaaaagcttaagaaagtttactgtcatcgatatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21329259 |
cagactccagctgaggtttgtgtttagtggcatctgttcatcgtttaactttgaaagttgttattggaaaagcttaagaaagtttactgtcatcgatatt |
21329160 |
T |
 |
| Q |
117 |
gtttagatattactagagttgctttccttttctacaggaatttgtccaagcaaagtgtgcgtgtctttgtgtgtgtgagagagaatagagaggggaactt |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21329159 |
gtttagatattattagagttgctttccttttctacaggaatttgtccaagcaaagtgtgcgtgtctttgtgtgtgtgagagagaatagagaggggaactt |
21329060 |
T |
 |
| Q |
217 |
tt |
218 |
Q |
| |
|
|| |
|
|
| T |
21329059 |
tt |
21329058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University