View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17669_high_5 (Length: 234)
Name: NF17669_high_5
Description: NF17669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17669_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29543760 - 29543540
Alignment:
| Q |
1 |
agaaaaagcttgtttaataggcaactccccgcaccaacaatcaaaccacaagcgatgaattgtctgatcttgatccaatagtagttgaagtggagaccgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29543760 |
agaaaaagcttgtttaataggcaactccccgcaccaaacatcaaaacacaaacgatgaattgtctgatcttgatccaatagtagttgaagtggagaccgc |
29543661 |
T |
|
| Q |
101 |
gtggatgcagaatgtggctgaatgcggccccggtgaatctgttgtgttcctggtggtccaagtctccatatgatcaagacattccaaggcacgccataac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29543660 |
gtggatgcagaatgtggctgaatgcggccccggtgaatctgttgtgttcctggtggtccaagtctccatatgatcaagacattccaaggcacgccataac |
29543561 |
T |
|
| Q |
201 |
gatgtttcgaaacacaaccat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29543560 |
gatgtttcgaaacacaaccat |
29543540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University