View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17669_high_6 (Length: 224)
Name: NF17669_high_6
Description: NF17669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17669_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 29543854 - 29544066
Alignment:
| Q |
1 |
attctttgtgacgtaaaatagggttaagggaaacacactttggagctttgtctcgaaaaacttgaaacaatgggaatttatccttacataagttgatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29543854 |
attctttgtgacgtaaaatagggttaagggaaacacactttggagctttgtctggaaaaacttgaaacaatgggaatttatccttaaataagttgatctt |
29543953 |
T |
 |
| Q |
101 |
gcttacaataatcaaactaatcaagctgcaaaaaagtgtccttttttaggcggtataaagaacttgacgacatatcccacttgaattatccccctcatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29543954 |
gcttacaataatcaaactaatcaagctgcaaaaaagtgtccttttttaggcggtataaagaacttgacgacatatcccacttgaattatccccctcatca |
29544053 |
T |
 |
| Q |
201 |
gataattaatatt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29544054 |
gataattaatatt |
29544066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University