View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17669_low_2 (Length: 288)

Name: NF17669_low_2
Description: NF17669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17669_low_2
NF17669_low_2
[»] chr7 (1 HSPs)
chr7 (1-267)||(24496587-24496853)
[»] chr4 (1 HSPs)
chr4 (1-260)||(4367040-4367299)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 24496587 - 24496853
Alignment:
1 tgccagaatattgacatagggatagtcttggcatcatagtagttattctttcggatcatgtcgaggcgaacgacttctagaatgccggcgatgatcatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||    
24496587 tgccagaatattgacatagggatagtcttggcatcatagtagttattctttcggatcatatcgagacgaacgacttctagaatgccggcgatgatcatgg 24496686  T
101 aaaagattgagaggactaggcctatgcccattgttagcaacagtttgaatccgtgttcgtggccggtgaactttctttcgtaagggagtaggacgcgatc 200  Q
    |||||||||||||||| |||||||| |||||| || | | | || |||||||||||||||||||||||||||||||| ||||||||| || || ||| ||    
24496687 aaaagattgagaggacaaggcctattcccattctttggagctgtgtgaatccgtgttcgtggccggtgaactttcttgcgtaagggactatgatgcggtc 24496786  T
201 gtaatcctgtgcccagaaggtgacgcgtagagtgtcgaaaagtgagtgggaagctgatggggtttgg 267  Q
    |||  || ||||||||||| |||||| ||||||||||||||||||| |||||||||||||| |||||    
24496787 gtataccggtgcccagaagatgacgcttagagtgtcgaaaagtgagagggaagctgatgggatttgg 24496853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 4367040 - 4367299
Alignment:
1 tgccagaatattgacatagggatagtcttggcatcatagtagttattctttcggatcatgtcgaggcgaacgacttctagaatgccggcgatgatcatgg 100  Q
    |||||||| || ||||||||||| || | |   ||||||||||| || || ||||  ||||||||||| | |||||||||||| || || | ||||||||    
4367040 tgccagaagatcgacatagggatggtttcgaggtcatagtagttgtttttgcggacaatgtcgaggcgtatgacttctagaatccctgccacgatcatgg 4367139  T
101 aaaagattgagaggactaggcctatgcccattgttagcaacagtttgaatccgtgttcgtggccggtgaactttctttcgtaagggagtaggacgcgatc 200  Q
    ||| |||||||| ||||||||| || || ||| || | | | || |||| |||||||| |  || ||| |||||||| || ||||||  | ||  || ||    
4367140 aaatgattgagatgactaggccgattccgattctttgaagctgtgtgaaaccgtgttcattaccagtgtactttcttgcgaaagggacgatgagacggtc 4367239  T
201 gtaatcctgtgcccagaaggtgacgcgtagagtgtcgaaaagtgagtgggaagctgatgg 260  Q
    |||  || | ||||||||| |||| | ||||||||||||||| ||| |||| ||||||||    
4367240 gtagaccggggcccagaagatgacacttagagtgtcgaaaagggagagggatgctgatgg 4367299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University