View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1766_low_6 (Length: 234)
Name: NF1766_low_6
Description: NF1766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1766_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 51278395 - 51278174
Alignment:
| Q |
17 |
actattgtcgtcttctc-tttatgtcctttacatgggatgaa-ggaaacgaattaagtctacccattgattttgttgaatggtacgtagcagcttctttg |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51278395 |
actattgtcgtcttctcctttatgtcctttacatgggatgaaaggaaacgaattaagtctacccattgattttgttgaatggtacgtagcagcttctttg |
51278296 |
T |
 |
| Q |
115 |
gttgacttaagagatgaatcatgaattgctttctatactt-----taatctcaagaaaactgatgcatggctaaacctgcttgacaaatacgtccatctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51278295 |
gttgacttaagagatgaatcatgaattgctttctatactttaatttaatctcaagacaactgatgcatggctaaacctgctacacaaatacgtccatctt |
51278196 |
T |
 |
| Q |
210 |
tgtctaattaaaaaatagagta |
231 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
51278195 |
tgtccaattaaaaaatagagta |
51278174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University