View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17670_high_16 (Length: 239)

Name: NF17670_high_16
Description: NF17670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17670_high_16
NF17670_high_16
[»] chr4 (1 HSPs)
chr4 (38-221)||(44086537-44086716)


Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 38 - 221
Target Start/End: Complemental strand, 44086716 - 44086537
Alignment:
38 caagagactcattggtttattcaaacctccaaacaagtgagaagttgagatggcatcatttgcaggcactacacagaaatgtaatacatgtgaaaagaaa 137  Q
    ||||||||||||||||||||||||||||||||    ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
44086716 caagagactcattggtttattcaaacctccaa----gtgagaatttgagatggcatcatttgcaggcactgcacagaaatgtaatacatgtgaaaagaaa 44086621  T
138 gtctactgggtggaacagctcactgctgataacaaagtgttccacaagtcttgcttcagatgccaccattgcaagggcacactc 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44086620 gtctactgggtggaacagctcactgctgataacaaagtgttccacaagtcttgcttcagatgccaccattgcaagggcacactc 44086537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University