View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17670_high_16 (Length: 239)
Name: NF17670_high_16
Description: NF17670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17670_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 38 - 221
Target Start/End: Complemental strand, 44086716 - 44086537
Alignment:
| Q |
38 |
caagagactcattggtttattcaaacctccaaacaagtgagaagttgagatggcatcatttgcaggcactacacagaaatgtaatacatgtgaaaagaaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44086716 |
caagagactcattggtttattcaaacctccaa----gtgagaatttgagatggcatcatttgcaggcactgcacagaaatgtaatacatgtgaaaagaaa |
44086621 |
T |
 |
| Q |
138 |
gtctactgggtggaacagctcactgctgataacaaagtgttccacaagtcttgcttcagatgccaccattgcaagggcacactc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086620 |
gtctactgggtggaacagctcactgctgataacaaagtgttccacaagtcttgcttcagatgccaccattgcaagggcacactc |
44086537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University