View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17670_high_7 (Length: 344)
Name: NF17670_high_7
Description: NF17670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17670_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 153 - 326
Target Start/End: Complemental strand, 27880849 - 27880676
Alignment:
| Q |
153 |
agtggtgagttgggtgttggtgaagaggttgaatttgaggaagtgtgcgtgtatggtacgcgcgttgaggagagtggtggttggagagttgagacattgg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27880849 |
agtggtgagttgggtgttggtgaagaggttgaatttgaggaagtgtgcgtgtatggtacgcgcgttgaggagagtggtagttggagagttgagacattgg |
27880750 |
T |
 |
| Q |
253 |
gatacaatggattggaacattggaatgagacagtttttgattttgttttgaacaatgatgaatgttagcgttgt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27880749 |
gatacaatggattggaacattggaatgagacagtttttgattttgttttgaacaatgatgaatgttagcgttgt |
27880676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 12 - 54
Target Start/End: Complemental strand, 27880990 - 27880948
Alignment:
| Q |
12 |
aagaatatgacgaaagtggtgggacctagcaaaggagtggatt |
54 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27880990 |
aagaacatgacgaaagtggtgggacctagcaaaggagtggatt |
27880948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University