View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17670_low_13 (Length: 262)
Name: NF17670_low_13
Description: NF17670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17670_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 4759953 - 4759725
Alignment:
| Q |
13 |
agcatagggaggaggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagc |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759953 |
agcataaggaggaggaggaggtggtggaagaaactgaaattttgctgcaaaagacagtgaagatgcttcactttggaagctgggaagagaaggagatagc |
4759854 |
T |
|
| Q |
113 |
tgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtcg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759853 |
tgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataacagaacttggagtggtgccggttttggtatctatggtggcgtca |
4759754 |
T |
|
| Q |
213 |
caggtggttagtcaccggagagcagggtt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4759753 |
caggtggttagtcaccggagagcagggtt |
4759725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 69 - 198
Target Start/End: Complemental strand, 26982283 - 26982154
Alignment:
| Q |
69 |
gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaagagattgaaagtttagttaaagaagatgttaaggttagaaagttgataa |
168 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||| ||| |||||||| ||||| | | | |||| ||||||||||||| ||||||||||| | |
|
|
| T |
26982283 |
gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaagatattgagatgctggctaaacaagatgttaaggtcagaaagttgatga |
26982184 |
T |
|
| Q |
169 |
cagaacttggagtggtgccggttttggtat |
198 |
Q |
| |
|
| |||||| | |||||||| || ||||||| |
|
|
| T |
26982183 |
ctgaacttcgggtggtgcctgtattggtat |
26982154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 69 - 121
Target Start/End: Original strand, 26999135 - 26999187
Alignment:
| Q |
69 |
gtgaagatgcttcactttggaagctgggaagagaaggagatagctgcaaaaga |
121 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||| ||| |||||||| |
|
|
| T |
26999135 |
gtgaagaagcttcactttgggagctgggaagagaaagaggaagcagcaaaaga |
26999187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University