View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17670_low_16 (Length: 254)
Name: NF17670_low_16
Description: NF17670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17670_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 38276598 - 38276416
Alignment:
| Q |
13 |
aatatcaacactactttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaagctttcttacctatgcattcctcagagccctaactat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38276598 |
aatatcaacactactttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaagctttctgacctatgcattcctcagagccctaactat |
38276499 |
T |
 |
| Q |
113 |
gaatgatgttattgcttatagaacatagcaaagatgaatatggaaaac-aatacaaaaaacatgtctcaatagtggaagaatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
38276498 |
gaatgatgttattgcttatagaacatagcaaagatgaatatggaaaacaaatacaaaaaacatgtctcaaaggtggaagaatt |
38276416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 38277806 - 38277743
Alignment:
| Q |
13 |
aatatcaacactactttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaag |
76 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38277806 |
aatatcaacactagtttggaaatatggtgaaacacatgatggcaacctttcatttcccatgaag |
38277743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 96
Target Start/End: Complemental strand, 26572384 - 26572301
Alignment:
| Q |
13 |
aatatcaacactactttggaaatatggtgaaacacatgatagcaacctttcatttcccatgaagctttcttacctatgcattcc |
96 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26572384 |
aatatcaacattactttggaaatataatgaaacacatgatagcaatctttcatttcccatgaagctttgagacctatgcattcc |
26572301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University