View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17670_low_22 (Length: 239)
Name: NF17670_low_22
Description: NF17670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17670_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 31506004 - 31505789
Alignment:
| Q |
1 |
tgtgcaaaactataactaagcctcagtta----gtaatataacattcatgttattattgtctagtagttgcttttcgtttaaggaaaactactatagtaa |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31506004 |
tgtgcaaaactataactaagcctcagttaattagtaatataacattcatgttattattgtctagtagttgcctttcgtttaaggaaaactactatagtaa |
31505905 |
T |
 |
| Q |
97 |
acacaggccgaggtatgtttagattagagatatttttatattgcattgtatagtagttaacagtattaaaccaaattccattccatttctagcttgatta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31505904 |
acacaggccgaggtatgtttagattagagatatttttatattgcattgca-agtagttaatattattaaaccaaattccattccatttctagcttgatta |
31505806 |
T |
 |
| Q |
197 |
atacctaaaccctatat |
213 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31505805 |
atacctaaaccctatat |
31505789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University