View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17671_low_2 (Length: 452)
Name: NF17671_low_2
Description: NF17671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17671_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 9e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 18097438 - 18097214
Alignment:
| Q |
11 |
agcagagatcactaagaaacgaatatgatgaactgaagctacttctcacccatgaaactgccatggacgattagtagatgatgacattgacagaggagga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18097438 |
agcagagatcactaagaaacgaatatgatgaactgaagctacttctcacccatgaaactgccatggacgattagtagatgatgacattgacagaggagga |
18097339 |
T |
 |
| Q |
111 |
gtaaaagggtttcagtaaattgtgnnnnnnnnattgtagtgataatttaattaaa---annnnnnnnnnggagagaaggtaatttaattaatattaatat |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| || | |||||||||||||||||| ||||||||||| |
|
|
| T |
18097338 |
gtaaaagggtttcagtaaattgtgttttttttattgtagtgataatttaatttaatttaattttttttttgagagaaggtaatttaatcaatattaatat |
18097239 |
T |
 |
| Q |
208 |
aaaacaagtactttttattttccct |
232 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
18097238 |
aaaacaactactttttattttccct |
18097214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 324 - 358
Target Start/End: Complemental strand, 18096973 - 18096939
Alignment:
| Q |
324 |
ctagcggtttattttgggaatgggaataaaattat |
358 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
18096973 |
ctagcgatttattttgggaatgggaataaaattat |
18096939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University